Sequence ID | >W1710916636 |
Genome ID | LNVL01000053 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Xanthomonas translucens [LNVL] |
Start position on genome | 4187 |
End posion on genome | 4262 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
cggtttccgt |
tRNA gene sequence |
GCCGCTTTAGCTCAGTCGGTAGAGCAACTGATTTGTAATCAGTAGGTCGTCCGTTCGATT |
Downstream region at tRNA end position |
cttttttgca |
Secondary structure (Cloverleaf model) | >W1710916636 Thr TGT t ACCA cttttttgca G - C C - G C - G G - C C - G T - A T - A T T T C A G G C A T G A A | | | | | G C C T C G G T C C G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |