| Sequence ID | >W1710917006 |
| Genome ID | LNVS01000033 |
| Phylum/Class | Gammaproteobacteria |
| Species | Xanthomonas translucens [LNVS] |
| Start position on genome | 26924 |
| End posion on genome | 27000 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
ccgcttctgc |
| tRNA gene sequence |
TGCGGGGTGGAGCAGTCTGGCAGCTCGTCGGGCTCATAACCCGAAGGTCGCAGGTTCAAA |
| Downstream region at tRNA end position |
tatttttcta |
| Secondary structure (Cloverleaf model) | >W1710917006 Met CAT
c ACCA tatttttcta
T T
G - C
C - G
G - C
G - C
G - C
G - C T A
T C G T C C A
T G A G | | | | | A
C C G A G G C A G G C
T | | | | T T
G G C T C
G C A G AGGTC
T - A
C - G
G - C
G - C
G - C
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |