Sequence ID | >W1710919190 |
Genome ID | LNXL01000003 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Tritonibacter mobilis [LNXL] |
Start position on genome | 8899 |
End posion on genome | 8974 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ctttcgcttc |
tRNA gene sequence |
GCCTCAATAGCTCAGCTGGTAGAGCAGGTCCTTCGTAAGGACAAGGTCGGGGGTTCGAGT |
Downstream region at tRNA end position |
cnnnnnnnnn |
Secondary structure (Cloverleaf model) | >W1710919190 Thr CGT c ACCA cnnnnnnnnn G - C C - G C - G T - A C - G A - T A - T T G T C T C C C A C G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A A AGGTC G A G - C T - A C - G C - G T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |