Sequence ID | >W1710924989 |
Genome ID | LODC01000036 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Escherichia coli [LODC] |
Start position on genome | 3158 |
End posion on genome | 3083 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ttcacacgat |
tRNA gene sequence |
TCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGAGT |
Downstream region at tRNA end position |
aattctaaaa |
Secondary structure (Cloverleaf model) | >W1710924989 Asn GTT t GCCA aattctaaaa T - A C - G C - G T - A C - G T - A G - C T G T T G A C C A T G A A | | | | | G C C T T G A C T G G C G | | | | T T G G A A C T A G ATGTC G + T C - G G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |