Sequence ID | >W131034037 |
Genome ID | AJGP01000009 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Isoalcanivorax pacificus W11-5 [AJGP] |
Start position on genome | 103998 |
End posion on genome | 104071 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ccagtttcac |
tRNA gene sequence |
GGCGCGGTGGCAGAGTGGTTATGCAGCGGACTGCAACTCCGTATACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
tatctttaaa |
Secondary structure (Cloverleaf model) | >W131034037 Cys GCA c TCCA tatctttaaa G - C G - C C - G G - C C - G G - C G - C T T T C A G C C A G A G | | | | G T G A C G G C C G G C G | | | T T G A T G C T T A ATAC G + T C - G G - C G - C A - T C C T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |