Sequence ID | >W1710962969 |
Genome ID | LPCT01000063 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Burkholderia multivorans [LPCT] |
Start position on genome | 29719 |
End posion on genome | 29794 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tttgctcttt |
tRNA gene sequence |
GGGTCGTTAGCTCAGTTGGTAGAGCAGCGGACTTTTAATCCGTTGGTCGCAGGTTCGAAT |
Downstream region at tRNA end position |
aagaattcaa |
Secondary structure (Cloverleaf model) | >W1710962969 Lys TTT t ACCA aagaattcaa G + T G - C G - C T + G C - G G - C T - A T A T C G T C C A T G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C T A A TGGTC G + T C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |