Sequence ID | >W1710980771 |
Genome ID | LPOW01000099 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Enterobacter cloacae subsp. cloacae [LPOW] |
Start position on genome | 180549 |
End posion on genome | 180624 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
gctttacgat |
tRNA gene sequence |
GGGGCTATAGCTCAGCTGGGAGAGCGCTTGCATGGCATGCAAGAGGTCAGCGGTTCGATC |
Downstream region at tRNA end position |
aaatttgaac |
Secondary structure (Cloverleaf model) | >W1710980771 Ala GGC t ACCA aaatttgaac G - C G - C G + T G - C C - G T - A A - T C T T T C G C C A C G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A G - C C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |