Sequence ID | >W1710982819 |
Genome ID | LPQD01000023 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Enterobacter hormaechei subsp. oharae [LPQD] |
Start position on genome | 495684 |
End posion on genome | 495759 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gcgctccgtt |
tRNA gene sequence |
GCCCGGATAGCTCAGTCGGTAGAGCAGGGGATTGAAAATCCCCGTGTCCTTGGTTCGATT |
Downstream region at tRNA end position |
ctatttaaag |
Secondary structure (Cloverleaf model) | >W1710982819 Phe GAA t ACCA ctatttaaag G - C C - G C - G C - G G - C G - C A - T T T T G A G C C A T G A A | | + | | G C C T C G C T T G G C G | | | | T T G G A G C T A A GTGTC G - C G - C G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |