Sequence ID | >W1710988700 |
Genome ID | LPVK01000018 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio parahaemolyticus [LPVK] |
Start position on genome | 9519 |
End posion on genome | 9435 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gcccagagat |
tRNA gene sequence |
GCCGGTGTGGTGAAATTGGTATACACGACGGATTCAAAATCCGTTGCCTTCGGGCGTGGC |
Downstream region at tRNA end position |
tattccaaga |
Secondary structure (Cloverleaf model) | >W1710988700 Leu CAA t ACCA tattccaaga G + T C - G C - G G - C G - C T - A G - C T G T C C G C C A T A A G | | | | | A T A G T G G G C G G C G | | | T T G A C A C T A T G TGCCTTCGGGCGT A - T C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |