| Sequence ID | >W1710996545 |
| Genome ID | LQBN01000001 |
| Phylum/Class | Gammaproteobacteria |
| Species | Thiomicrospira sp. WB1 [LQBN] |
| Start position on genome | 671731 |
| End posion on genome | 671806 |
| Amino Acid | His |
| Anticodon | GTG |
| Upstream region at tRNA start position |
tccatctatg |
| tRNA gene sequence |
GCGGATGTAGCTCAGTTGGTAGAGCCCAGGATTGTGATTCCTGTTGTCGCGGGTTCGATC |
| Downstream region at tRNA end position |
tttttcttgt |
| Secondary structure (Cloverleaf model) | >W1710996545 His GTG
g CCCA tttttcttgt
G - C
C - G
G - C
G + T
A - T
T - A
G - C C T
T T G C C C A
T G A A + | | | | G
T C T C G G C G G G C
G | | | | T T
G G A G C
T A C TTGTC
C - G
A - T
G - C
G - C
A - T
T T
T A
G T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |