Sequence ID | >W1710997229 |
Genome ID | LQCA01000036 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio cholerae [LQCA] |
Start position on genome | 25951 |
End posion on genome | 26025 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tcatcacagc |
tRNA gene sequence |
AGGTCTGTCGCCAAGCGGTAAGGCAACGGGTTTTGATCCCGTCATACCTAGGTTCGAATC |
Downstream region at tRNA end position |
tttttcaaac |
Secondary structure (Cloverleaf model) | >W1710997229 Gln TTG c GCCA tttttcaaac A - T G - C G - C T - A C - G T - A G - C T A T G A T C C A G A C | | | | | G C A C C G C T A G G C G | | | T T G A G G C T A A CATAC A - T C - G G - C G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |