Sequence ID | >W1710998394 |
Genome ID | LQCS01000021 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio parahaemolyticus [LQCS] |
Start position on genome | 55796 |
End posion on genome | 55713 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gcatcatgat |
tRNA gene sequence |
GCCGAGATGGTGAAATTGGTAGACACGCTAGCATGAGGTGCTAGTGCCTTAGGTGTGAGG |
Downstream region at tRNA end position |
ttatccttct |
Secondary structure (Cloverleaf model) | >W1710998394 Leu GAG t ACCA ttatccttct G - C C - G C - G G - C A - T G - C A - T T G T C T C C C A T A A G | | | | | G T A G T G G A G G G C G | | | T T G A C A C T A G G TGCCTTAGGTGT C - G T - A A - T G - C C - G A T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |