Sequence ID | >W131059503 |
Genome ID | ANGO01000029 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Campylobacter jejuni subsp. jejuni BIGS0004 [ANGO] |
Start position on genome | 36927 |
End posion on genome | 37000 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
acattatcag |
tRNA gene sequence |
GGCGACATAGCCAAGCGGTAAGGCATGGGCCTGCAAAGCCTTGATCTCCGGTTCGAATCC |
Downstream region at tRNA end position |
aaaggcaaaa |
Secondary structure (Cloverleaf model) | >W131059503 Cys GCA g TCCA aaaggcaaaa G - C G - C C - G G - C A - T C - G A - T T A T A G G C C A G A A | | | | | G C A C C G T C C G G C G | | | T T G A G G C T A A GATC T T G + T G - C G - C C - G C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |