Sequence ID | >W131062402 |
Genome ID | ANJU01000009 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Lacticaseibacillus paracasei subsp. paracasei Lpp74 [ANJU] |
Start position on genome | 56361 |
End posion on genome | 56434 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
gttaagttaT |
tRNA gene sequence |
TGGGTAGTAGCGAAGTGGTAACGCAGTGGACTCTGAATCCATAATCATAGGTTCGATCCC |
Downstream region at tRNA end position |
cgatattaaa |
Secondary structure (Cloverleaf model) | >W131062402 Gln CTG T AGCg cgatattaaa T - A G - C G - C G - C T - A A - T G - C C T T T A T C C A G A A | | | | | G T A G C G A T A G G C G | | | T T G A C G C T A A AATC G + T T - A G - C G - C A - T C A T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |