| Sequence ID | >W1711009616 |
| Genome ID | LQQU01000059 |
| Phylum/Class | Betaproteobacteria |
| Species | Crenobacter luteus [LQQU] |
| Start position on genome | 69813 |
| End posion on genome | 69738 |
| Amino Acid | Gly |
| Anticodon | GCC |
| Upstream region at tRNA start position |
tctgtgtgac |
| tRNA gene sequence |
GCGGGAATAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAGGTCGCGAGTTCGAGC |
| Downstream region at tRNA end position |
tccttcacgc |
| Secondary structure (Cloverleaf model) | >W1711009616 Gly GCC
c TCCA tccttcacgc
G - C
C - G
G - C
G - C
G - C
A - T
A - T C G
T T G C T C A
T G A A + | | | | G
T C T C G G C G A G C
G | | | | T T
G G A G C
T A G AGGTC
C - G
A - T
A - T
C - G
C - G
T A
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |