Sequence ID | >W1711035976 |
Genome ID | LRJL01000001 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Enterobacter hormaechei subsp. steigerwaltii [LRJL] |
Start position on genome | 355899 |
End posion on genome | 355815 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
catctttttt |
tRNA gene sequence |
GCGGGAGTGGCGAAATTGGTAGACGCACCAGATTTAGGTTCTGGCGCCGCAAGGTGTGCG |
Downstream region at tRNA end position |
ttcccaggta |
Secondary structure (Cloverleaf model) | >W1711035976 Leu TAG t ACCA ttcccaggta G - C C - G G - C G - C G - C A - T G - C T G T C G C T C A T A A G | | | | | A T A G C G G C G A G C G | | | T T G A C G C T A G A CGCCGCAAGGTGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |