Sequence ID | >W1711041669 |
Genome ID | LRLO01000106 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Escherichia coli [LRLO] |
Start position on genome | 36491 |
End posion on genome | 36567 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
agcagtattt |
tRNA gene sequence |
CGGCGAGTAGCGCAGCTTGGTAGCGCAACTGGTTTGGGACCAGTGGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
attttgaacc |
Secondary structure (Cloverleaf model) | >W1711041669 Pro TGG t ACCA attttgaacc C - G G - C G - C C - G G - C A - T G - C T A T T C T C C A C G A A + | | | | G T C G C G G G A G G C T | | | | T T G G C G C G T A A GGGTC A - T C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |