Sequence ID | >W131091011 |
Genome ID | AOGM01000063 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Escherichia coli O08 [AOGM] |
Start position on genome | 847 |
End posion on genome | 774 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
gcatctcgaa |
tRNA gene sequence |
GCGGGCGTAGTTCAATGGTAGAACGAGAGCTTCCCAAGCTCTATACGAGGGTTCGATTCC |
Downstream region at tRNA end position |
atcaatttat |
Secondary structure (Cloverleaf model) | >W131091011 Gly CCC a TCCA atcaatttat G - C C - G G - C G - C G - C C - G G - C T T T T T C C C A A A A + | | | | G T C T T G G A G G G C G | | | | T T G G A A C T A G ATAC A - T G - C A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |