Sequence ID | >W1711049405 |
Genome ID | LRQT01000023 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Veillonella atypica [LRQT] |
Start position on genome | 889 |
End posion on genome | 965 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
ccaagtacat |
tRNA gene sequence |
GACTCAGTAGCTCAGCTGGATAGAGCGTTTGACTACGAATCAAAAGGCCAGGGGTTCGAA |
Downstream region at tRNA end position |
aattaaaact |
Secondary structure (Cloverleaf model) | >W1711049405 Arg ACG t ACCA aattaaaact G - C A - T C - G T + G C - G A - T G - C T A T T T C C C A C G A A | + | | | G T C T C G A G G G G C G | | | | T T G G A G C A T A G AGGCC T - A T - A T - A G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |