Sequence ID | >W131099687 |
Genome ID | AOTL01000021 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Methylotuvimicrobium buryatense 5G [AOTL] |
Start position on genome | 588888 |
End posion on genome | 588812 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tccgattcaa |
tRNA gene sequence |
GCCCCGGTAGCTCAGCTGGATAGAGCATCCCCCTCCTAAGGGGAAGGTCACACGTTCGAA |
Downstream region at tRNA end position |
taaaatcaaa |
Secondary structure (Cloverleaf model) | >W131099687 Arg CCT a GCCA taaaatcaaa G - C C - G C - G C - G C - G G - C G + T T A T T G T G C A C G A A | | | | | G T C T C G A C A C G C G | | | | T T G G A G C A T A A AGGTC T - A C - G C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |