Sequence ID | >W1711053714 |
Genome ID | LRTH01000015 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio parahaemolyticus [LRTH] |
Start position on genome | 98498 |
End posion on genome | 98425 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
gttgaagaaa |
tRNA gene sequence |
GGCGCGTTGGCAGAGTGGCTATGCAGCGGATTGCAAATCCGTGGACCTCGGTTCGACTCC |
Downstream region at tRNA end position |
tttgcgacac |
Secondary structure (Cloverleaf model) | >W1711053714 Cys GCA a TCCA tttgcgacac G - C G - C C - G G - C C - G G - C T - A T C T G G G C C A G A G | + | | | G T G A C G C T C G G C G | | | T T G A T G C C T A GGAC G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |