Sequence ID | >W1711055048 |
Genome ID | LRUH01000029 |
Phylum/Class | Alphaproteobacteria |
Species | Wolbachia endosymbiont of Laodelphax striatellus of Laodelphax striatella [LRUH] |
Start position on genome | 4032 |
End posion on genome | 3960 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
taaacaatat |
tRNA gene sequence |
TGGGGTGTAGCCAAGTGGTAAGGCAGCGGTTTTTGATACCGCCACGCGAAGGTTCGAATC |
Downstream region at tRNA end position |
tattaaagtg |
Secondary structure (Cloverleaf model) | >W1711055048 Gln TTG t GCtt tattaaagtg T - A G - C G - C G - C G - C T - A G - C T A T C T T C C A G A A | | | | | G T A C C G G A A G G C G | | | T T G A G G C T A A CACGC G - C C - G G - C G - C T - A T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |