Sequence ID | >W1711059954 |
Genome ID | LRXL01000026 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Cochleicola gelatinilyticus LPB0005 [LRXL] |
Start position on genome | 696715 |
End posion on genome | 696641 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tatatgaaat |
tRNA gene sequence |
TCCTCTTTAGCTCAGTTGGTTAGAGCATCTGACTGTTAATCAGAGGGTCCTTGGTTCGAG |
Downstream region at tRNA end position |
aaaaaatccc |
Secondary structure (Cloverleaf model) | >W1711059954 Asn GTT t GCtg aaaaaatccc T - A C - G C - G T - A C - G T - A T - A C G T G A A C C A T G A A | | | | | G T C T C G C T T G G C G | | | | T T G G A G C T T A A GGGTC T - A C - G T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |