Sequence ID | >W131109497 |
Genome ID | APHX01000009 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Megasphaera sp. BL7 [APHX] |
Start position on genome | 4542 |
End posion on genome | 4615 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ctccatatat |
tRNA gene sequence |
GGCGGCATAGCCAAGCGGTAAGGCAGAGGTCTGCAAAACCTTCATCCCCAGTTCGATTCT |
Downstream region at tRNA end position |
tattttcatc |
Secondary structure (Cloverleaf model) | >W131109497 Cys GCA t TCCA tattttcatc G - C G - C C - G G - C G - C C - G A - T T T T G G G T C A G A A | | | | | G C A C C G C C C A G C G | | | T T G A G G C T A A CATC G + T A - T G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |