Sequence ID | >W1711067303 |
Genome ID | LSDS01000031 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Veillonellaceae bacterium DNF00751 [LSDS] |
Start position on genome | 29504 |
End posion on genome | 29428 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
tcccttacat |
tRNA gene sequence |
GACTCGGTAGCTCAGCTGGATAGAGTGACTGACTACGAATCAGTAGGTCTAGGGTTCGAA |
Downstream region at tRNA end position |
tttgagtaag |
Secondary structure (Cloverleaf model) | >W1711067303 Arg ACG t ACCA tttgagtaag G - C A - T C - G T + G C - G G - C G - C T A T A T C C C A C G A A | | | | | G T C T C G T A G G G C G | | | + T T G G A G T A T A G AGGTC A - T C - G T - A G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |