Sequence ID | >W1711069100 |
Genome ID | LSFI01000041 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Thermodesulfatator autotrophicus [LSFI] |
Start position on genome | 2509 |
End posion on genome | 2595 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aaaagagcgt |
tRNA gene sequence |
GCCGAGGTGGTGGAATTGGTAGACACGCTGTCTTGAGGGGGCAGTGGGCGTAAGCCCGTG |
Downstream region at tRNA end position |
cttaagtcaa |
Secondary structure (Cloverleaf model) | >W1711069100 Leu GAG t ACCA cttaagtcaa G - C C - G C - G G - C A - T G - C G - C T G T C G C C C A T A A G | | | | | G T G G T G G C G G G C G | | | T T G A C A C T A G G TGGGCGTAAGCCCGT C - G T - A G - C T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |