| Sequence ID | >W1711073249 |
| Genome ID | LSIJ01000024 |
| Phylum/Class | Alphaproteobacteria |
| Species | Sphingomonas sp. CCH10-B3 [LSIJ] |
| Start position on genome | 22660 |
| End posion on genome | 22736 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
gtgtcagcgt |
| tRNA gene sequence |
CGGGGAGTGGCGCAGTCTGGTAGCGCGCCTGCTTTGGGAGCAGGATGTCGCAGGTTCGAA |
| Downstream region at tRNA end position |
cgcttgcgcg |
| Secondary structure (Cloverleaf model) | >W1711073249 Pro TGG
t ACCA cgcttgcgcg
C - G
G - C
G - C
G - C
G - C
A - T
G - C T A
T T G T C C A
T G A G + | | | | G
C C G C G G C A G G C
T | | | | T T
G G C G C
G T A G ATGTC
C - G
C - G
T - A
G - C
C - G
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |