Sequence ID | >W1711080699 |
Genome ID | LSRF01000058 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Tsukamurella pseudospumae [LSRF] |
Start position on genome | 1033096 |
End posion on genome | 1033020 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ttttccccgc |
tRNA gene sequence |
GCCCCCATAGCCCAATTGGCAGAGGCAGCAGACTTAAAATCTGCGCAGTGTCGGTTCGAG |
Downstream region at tRNA end position |
cacttccacc |
Secondary structure (Cloverleaf model) | >W1711080699 Leu TAA c ACCG cacttccacc G - C C - G C - G C - G C - G C - G A - T T G T C A G C C A T A A A | | | | | G T C C C G G T C G G C G | | | T T G A G G C C A G A GCAGT G - C C - G A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |