Sequence ID | >W1711083199 |
Genome ID | LSUV01000078 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Raoultella planticola [LSUV] |
Start position on genome | 102348 |
End posion on genome | 102424 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
ctccatacgt |
tRNA gene sequence |
CGGCACGTAGCGCAGCCTGGTAGCGCACCGTCATGGGGTGTCGGGGGTCGGAGGTTCAAA |
Downstream region at tRNA end position |
aaaaatccca |
Secondary structure (Cloverleaf model) | >W1711083199 Pro GGG t ACCA aaaaatccca C - G G - C G - C C - G A - T C - G G - C T A T T C T C C A C G A A + | | | | A C C G C G G G A G G C T | | | | T T G G C G C G T A A GGGTC C - G C - G G - C T T C - G A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |