Sequence ID | >W1711084205 |
Genome ID | LSVN01000063 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Corynebacterium diphtheriae bv. mitis [LSVN] |
Start position on genome | 19285 |
End posion on genome | 19360 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
aacacagcct |
tRNA gene sequence |
GTCTCCGTAGCTCAGTGGATAGAGCATTGGTTTCCGGTACCAAAGGTCGCAAGTTCGAAT |
Downstream region at tRNA end position |
tttttataaa |
Secondary structure (Cloverleaf model) | >W1711084205 Arg CCG t ACAA tttttataaa G - C T - A C - G T + G C - G C - G G - C T A T T G T T C A T G A A + | | | | G G C T C G G C A A G C G | | | | T T A G A G C T A A AGGTC T - A T - A G - C G - C T - A T T T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |