Sequence ID | >W1711086607 |
Genome ID | LSXJ01000016 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Corynebacterium diphtheriae bv. gravis [LSXJ] |
Start position on genome | 135993 |
End posion on genome | 136068 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ataacggtat |
tRNA gene sequence |
GCGCCTTTAGCTCAGCTGGGAGAGCAGCTGGTTTACACCCAGCAGGTCGGCGGTTCGATC |
Downstream region at tRNA end position |
tggttacaag |
Secondary structure (Cloverleaf model) | >W1711086607 Val TAC t ACAA tggttacaag G - C C - G G - C C - G C - G T + G T - A C T T C T G C C A C G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C G A A AGGTC G - C C - G T - A G - C G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |