Sequence ID | >W1711093482 |
Genome ID | LTFB01000021 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas aeruginosa HMSC066B03 [LTFB] |
Start position on genome | 68157 |
End posion on genome | 68082 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tcgtaatatg |
tRNA gene sequence |
GTGGGCGTAGCTCAGTTGGTAGAGCACAGGATTGTGGCTCCTGGTGTCGTGGGTTCGATT |
Downstream region at tRNA end position |
tattccgaag |
Secondary structure (Cloverleaf model) | >W1711093482 His GTG g CCCA tattccgaag G - C T - A G - C G - C G + T C - G G - C T T T T A C C C A T G A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A A GTGTC C - G A - T G - C G - C A - T T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |