Sequence ID | >W1711097833 |
Genome ID | LTJB01000011 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Lactobacillus sp. HMSC064F12 [LTJB] |
Start position on genome | 29489 |
End posion on genome | 29415 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
tttgtgtttT |
tRNA gene sequence |
GGGTCCATAGCTCAGTTGGGAGAGCGCCTGCTTCGCATGTAGGAGGTCGACGGTTCAAGT |
Downstream region at tRNA end position |
ttgaaagtcg |
Secondary structure (Cloverleaf model) | >W1711097833 Ala CGC T ATaa ttgaaagtcg G - C G - C G + T T - A C - G C - G A - T T G T T T G C C A T G A A + | | | | A T C T C G G A C G G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G + T C - G T T T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |