Sequence ID | >W1711107399 |
Genome ID | LTST01000044 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Eikenella sp. HMSC073A11 [LTST] |
Start position on genome | 11038 |
End posion on genome | 11113 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
aacatcacat |
tRNA gene sequence |
GGGTCGTTAGCTCAGTTGGTAGAGCAGCGGACTCTTAATCCGTAGGTCGAGCGTTCGATC |
Downstream region at tRNA end position |
aaataaaacc |
Secondary structure (Cloverleaf model) | >W1711107399 Lys CTT t ACCA aaataaaacc G - C G - C G - C T - A C - G G - C T - A C T T C T C G C A T G A A | | | | | G T C T C G G A G C G C G | | | | T T G G A G C T A A AGGTC G + T C - G G - C G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |