Sequence ID | >W1711110391 |
Genome ID | LTVN01000007 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Haemophilus sp. HMSC073C03 [LTVN] |
Start position on genome | 218 |
End posion on genome | 143 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ctaatcaatg |
tRNA gene sequence |
GTGGCTATAGCTCAGTTGGTAGAGCCCTGGATTGTGATTCCAGTTGTCGTGGGTTCGAAT |
Downstream region at tRNA end position |
tcttctctta |
Secondary structure (Cloverleaf model) | >W1711110391 His GTG g CCCA tcttctctta G - C T - A G - C G - C C - G T - A A - T T A T T A C C C A T G A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A C TTGTC C - G T - A G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |