Sequence ID | >W131160215 |
Genome ID | AQWK01000003 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Novosphingobium nitrogenifigens DSM 19370 [AQWK] |
Start position on genome | 376277 |
End posion on genome | 376350 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ggcgtaccga |
tRNA gene sequence |
GCGGGTATAGCTTAGTGGTAAAGTCCTAGCCTTCCAAGCTAGTCAGGCGGGTTCGATTCC |
Downstream region at tRNA end position |
actccctttc |
Secondary structure (Cloverleaf model) | >W131160215 Gly TCC a TCCA actccctttc G - C C - G G - C G - C G - C T - A A - T T T T C G C C C A G A A | | | | | G T T T C G G C G G G C G | | | + T T G A A G T T A C TCAG C - G T - A A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |