| Sequence ID | >W1711125571 |
| Genome ID | LUNK01000024 |
| Phylum/Class | Gammaproteobacteria |
| Species | Alteromonas macleodii [LUNK] |
| Start position on genome | 3624 |
| End posion on genome | 3551 |
| Amino Acid | Cys |
| Anticodon | GCA |
| Upstream region at tRNA start position |
agacgcatct |
| tRNA gene sequence |
GGCGGAATGGCAGAATGGCTATGCAGCGGATTGCAAATCCGTCTATCTCGGTTCGACTCC |
| Downstream region at tRNA end position |
aacgctgcaa |
| Secondary structure (Cloverleaf model) | >W1711125571 Cys GCA
t TCCA aacgctgcaa
G - C
G - C
C - G
G - C
G - C
A - T
A - T T C
T G G G C C A
A A G | + | | | G
T G A C G C T C G G C
G | | | T T
G A T G C
C T A CTAT
G + T
C - G
G - C
G - C
A - T
T A
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |