Sequence ID | >W1711129666 |
Genome ID | LUUF01000084 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Methylomonas methanica [LUUF] |
Start position on genome | 28877 |
End posion on genome | 28793 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
agcaaattaa |
tRNA gene sequence |
GCCGACGTGGTGAAATTGGTAGACACGCCATCTTGAGGGGGTGGTGACGCAAGTCGTGGC |
Downstream region at tRNA end position |
tttgaagatg |
Secondary structure (Cloverleaf model) | >W1711129666 Leu GAG a ACCA tttgaagatg G + T C - G C - G G - C A - T C - G G - C T G T C C G C C A T A A G | | | | | A T A G T G G G C G G C G | | | T T G A C A C T A G G TGACGCAAGTCGT C - G C - G A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |