Sequence ID | >W131165556 |
Genome ID | ARBR01000001 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Lewinella cohaerens DSM 23179 [ARBR] |
Start position on genome | 117808 |
End posion on genome | 117734 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gatcaaatga |
tRNA gene sequence |
GGTCCGTTCGTCTAGGGGTTAGGACGCCAGGTTTTCATCCTGGTAACACGGGTTCGATTC |
Downstream region at tRNA end position |
agcgtaaggt |
Secondary structure (Cloverleaf model) | >W131165556 Glu TTC a ACCA agcgtaaggt G + T G - C T - A C - G C - G G - C T - A T T T T G C C C A G G A C | | | | | G G T C T G A C G G G C G + | | | T T T G G A C T A G TAAC C - G C - G A - T G - C G - C T T T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |