| Sequence ID | >W1711138283 |
| Genome ID | LVCQ01000096 |
| Phylum/Class | Gammaproteobacteria |
| Species | Piscirickettsiaceae bacterium NZ-RLO1 NZ-RLO [LVCQ] |
| Start position on genome | 6259 |
| End posion on genome | 6335 |
| Amino Acid | Arg |
| Anticodon | ACG |
| Upstream region at tRNA start position |
tataatcgac |
| tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGTACCTGGCTACGAACCAGGCGGTCGGAGGTTCGAA |
| Downstream region at tRNA end position |
acttaccttg |
| Secondary structure (Cloverleaf model) | >W1711138283 Arg ACG
c GCCA acttaccttg
G - C
C - G
G - C
C - G
C - G
C - G
G - C T A
T C T T C C A
C G A A | + | | | G
T C T C G G G A G G C
G | | | + T T
G G A G T
A T A A CGGTC
C - G
C - G
T - A
G - C
G - C
C A
T A
A C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |