Sequence ID | >W1711147432 |
Genome ID | LVJQ01001492 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Rhodanobacter sp. FW104-R5 [LVJQ] |
Start position on genome | 1439 |
End posion on genome | 1514 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
taaaacttcc |
tRNA gene sequence |
GCTCATGTAGCTCAGTCGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCACAGGTTCGATT |
Downstream region at tRNA end position |
ttccttcggc |
Secondary structure (Cloverleaf model) | >W1711147432 Thr GGT c ACCA ttccttcggc G - C C - G T - A C - G A - T T - A G - C T T T T G T C C A T G A A | | | | | G C C T C G A C A G G C G | | | | T T G G A G C T A A AGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |