Sequence ID | >W1711147693 |
Genome ID | LVJV01001511 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Rhodanobacter sp. FW510-R12 [LVJV] |
Start position on genome | 4723 |
End posion on genome | 4799 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
gccgtagcgt |
tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCATCTGCCTGGGGGGCAGAGGGTCGTCGGTTCGAA |
Downstream region at tRNA end position |
attcggaaga |
Secondary structure (Cloverleaf model) | >W1711147693 Pro GGG t ACCA attcggaaga C - G G - C G - C G - C G - C C - G G - C T A T C G G C C A C G A A | + | | | G C C G C G G T C G G C T | | | | T T G G C G C G T A A GGGTC T - A C - G T - A G - C C - G C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |