| Sequence ID | >W1711168372 |
| Genome ID | LVXZ01000293 |
| Phylum/Class | Acidithiobacillia |
| Species | Acidithiobacillus ferrooxidans [LVXZ] |
| Start position on genome | 3734 |
| End posion on genome | 3646 |
| Amino Acid | Ser |
| Anticodon | CGA |
| Upstream region at tRNA start position |
atgcccccac |
| tRNA gene sequence |
GGAGAGGTACCGAAGTGGCCATAACGGCGCCGACTCGAAATCGGATGGGGGGCAACCCCA |
| Downstream region at tRNA end position |
acaccatgca |
| Secondary structure (Cloverleaf model) | >W1711168372 Ser CGA
c GCCA acaccatgca
G - C
G - C
A - T
G - C
A - T
G - C
G - C T A
T C A C C C A
G T G A A | | | | | G
G A G C C G T G G G C
C | | | T T
C A C G G
A T A C TGGGGGGCAACCCCAC
G A
C - G
C - G
G - C
A - T
C A
T A
C G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |