| Sequence ID | >W1711169882 |
| Genome ID | LVZL01000067 |
| Phylum/Class | Acidithiobacillia |
| Species | Acidithiobacillus ferrivorans [LVZL] |
| Start position on genome | 69014 |
| End posion on genome | 68930 |
| Amino Acid | Leu |
| Anticodon | GAG |
| Upstream region at tRNA start position |
caagcgttaa |
| tRNA gene sequence |
GCCGAAGTGGTGAAATTGGTAGACACACCGTCTTGAGGGGGCGGCGGCGCAAGCTATACC |
| Downstream region at tRNA end position |
aattgcagcc |
| Secondary structure (Cloverleaf model) | >W1711169882 Leu GAG
a ACCA aattgcagcc
G - C
C - G
C - G
G - C
A - T
A - T
G - C T G
T T G G C C A
T A A G | | | | | G
T A G T G A C C G G C
G | | | T T
G A C A C
T A G A CGGCGCAAGCTAT
C - G
C - G
G - C
T + G
C - G
T G
T G
G A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |