Sequence ID | >W1711174519 |
Genome ID | LWEG01000054 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Erythrobacter sp. HI00D59 [LWEG] |
Start position on genome | 431392 |
End posion on genome | 431318 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gcgcacctgc |
tRNA gene sequence |
TGGGGTGTAGCCAAGTGGTAAGGCATCGGTTTTTGGTACCGACATTCGCAGGTTCGATCC |
Downstream region at tRNA end position |
gttttccgaa |
Secondary structure (Cloverleaf model) | >W1711174519 Gln TTG c GCCA gttttccgaa T - A G - C G - C G - C G - C T - A G - C C T T C G T C C A G A A | | | | | G T A C C G G C A G G C G | | | T T G A G G C T A A CATTC T - A C - G G - C G - C T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |