Sequence ID | >W1711175702 |
Genome ID | LWEX01000606 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sulfitobacter sp. HI0040 HI0040 [LWEX] |
Start position on genome | 12336 |
End posion on genome | 12260 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gccccgtggc |
tRNA gene sequence |
GGGCCTGTAGCTCAATTGGTTAGAGCAGAGCGCTCATAACGCTTTGGTTGCGGGTTCAAG |
Downstream region at tRNA end position |
tgccgtcacc |
Secondary structure (Cloverleaf model) | >W1711175702 Met CAT c ACCA tgccgtcacc G + T G - C G - C C - G C - G T + G G - C T G T C G T C C A T A A A | | + | | A T C T C G G C G G G C G | | | | T T G G A G C T T A A TGGTT G + T A - T G - C C - G G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |