Sequence ID | >W1711175779 |
Genome ID | LWEZ01000465 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Alcanivorax sp. HI0044 [LWEZ] |
Start position on genome | 299 |
End posion on genome | 374 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
aaagagttac |
tRNA gene sequence |
AGGCCAGTAGTTCAATTGGTAGAGCACCGGTCTCCAAAACCGGCTGTTGGGGGTTCGAGT |
Downstream region at tRNA end position |
attttcccaa |
Secondary structure (Cloverleaf model) | >W1711175779 Trp CCA c GCCA attttcccaa A - T G - C G - C C - G C - G A - T G - C T G T C T C C C A T A A A | + | | | G T C T T G G G G G G C G | | + | T T G G A G C T A A CTGTT C - G C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |