Sequence ID | >W1711176738 |
Genome ID | LWFO01000090 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Erythrobacter sp. HI0074 [LWFO] |
Start position on genome | 8306 |
End posion on genome | 8232 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ggcgagatgt |
tRNA gene sequence |
GCTGCTGTAGCTCAGTGGTAGAGCGCACCCTTGGTAAGGGTGAGGCCGGGAGTTCAATCC |
Downstream region at tRNA end position |
tttcccatat |
Secondary structure (Cloverleaf model) | >W1711176738 Thr GGT t ACCA tttcccatat G - C C - G T - A G - C C - G T - A G - C C T T C C C T C A G A A | | | | | A T C T C G G G G A G C G | | | | T T G G A G C T A G AGGCC C - G A - T C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |