Sequence ID | >W131185079 |
Genome ID | ARTL01000012 |
Search identical group | |
Phylum/Class | Mycoplasmatota |
Species | Mesomycoplasma hyorhinis ATCC 17981 [ARTL] |
Start position on genome | 27628 |
End posion on genome | 27701 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ttactttaat |
tRNA gene sequence |
GGCACCATAGCCAAATGGTAAGGCATAGGTCTGCAACACCTTGATTACCGGTTCGAGTCC |
Downstream region at tRNA end position |
tgcgcttgta |
Secondary structure (Cloverleaf model) | >W131185079 Cys GCA t TCCA tgcgcttgta G - C G - C C - G A - T C - G C - G A - T T G T T G G C C A A A A | | | | | G T A C C G A C C G G C G | | | T T G A G G C T A A GATT T T A - T G - C G - C T - A C C T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |