Sequence ID | >W1711183742 |
Genome ID | LWLG01000017 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Thermosulfurimonas dismutans [LWLG] |
Start position on genome | 19560 |
End posion on genome | 19487 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gcccataacc |
tRNA gene sequence |
GGGCCGGTAACTCAGCTGGCAGAGTACTGGCCTTTTAAGCCAGGAGTCGCAGGTTCGAAT |
Downstream region at tRNA end position |
gaggatcaag |
Secondary structure (Cloverleaf model) | >W1711183742 Lys TTT c ACtt gaggatcaag G - C G - C G - C C - G C - G G - C G - C T A T C G T C C A C G A A | | | | | G T C T C A G C A G G C G | | | | T T G G A G T C A A GAGTC C - G T - A G - C G - C C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |